Thoughts on the Atacama (non) Alien and Unidentified DNA

by drmsheiser | Jul 3, 2013

If you’ve been reading the comments to the posts I’ve written about Steven Greer’s alleged six-inch alien specimen, you’ll notice that several folks have presumed that the 9% unidentified DNA means the specimen is alien or an alien-human hybrid.

That isn’t the case. But since I’m no expert in genetics, I asked a friend who is to comment on that issue. (He has a PhD in biochemistry and an expertise in genetics and bioinformatics). He’s kindly obliged.

Here’s an excerpt from my email to him of a couple days ago and his response:

MSH: The discussion of this anomaly is ongoing. . . . The sticking point for many readers is the notion that 9% of the DNA cannot be identified. Many jump to the conclusion that this means the specimen is 9% alien. . . . The Stanford researcher who did the analysis says that the DNA he examined was not contaminated. You’d told me before (in relation to another “alien hybrid” specimen) that such inability to identify DNA is because (as memory serves) parts of the genome being examined don’t show up in a registry of some kind. Could you give me a paragraph (for non-specialists) as to how you would explain why DNA can’t be identified in DNA tests?

RESPONSE:

“9% unidentified” and “9% different” are two completely different comparisons. They’re not even related.

9% different is based on alignments. Comparing two sequences together requires a an alignment – where we can say for certain that some percentage of nucleotides in the complete alignment don’t match. Like so:

AGCTAGCTAGCTAGCTAGCTAGCT
AGCTAGCTAGGTAGCTAGCTAGCT

In the second sequence there’s a G that’s different from the C in the first sequence, but I know that’s the difference because it’s surrounded by matching nucleotides. There’s no funny business going on, it’s a genuine sequence mismatch – a real difference.

“9% unidentified” means there’s no alignment. So we have to ask, why is there no alignment? There can be a whole host of answers to that. It could be a sequence of human DNA that’s not been sequenced before (unlikely but it could happen), so it’s not in the database. That could happen in the case of local insertional variations. It could be poor quality sequence – DNA that the sequencing machine just didn’t read correctly. It could be chimeric sequence – where two pieces are stuck together that aren’t connected in the actual chromosome, so they don’t match the correct sequences in the database.

Most likely, it’s fungal and bacterial contamination that’s not in the database. At 9%, that would be the most likely explanation. If they say there’s no contamination, that’s because they don’t understand contamination. The vast majority of forensic DNA (including aDNA) that gets sequenced is contamination. It’s impossible not to get contamination from aDNA extractions.

8 Comments

  1. Dave Lewis`

    I did a quick search on aDNA and didn’t find an explanation of that term.

    Can anyone enlighten me?

    Dave Lewis

  2. BUYERS BEWARE

    NO ALIEN GRAY DNA IN THEIR DATA BASE
    Hi Michael,
    A much more logical reason is because those doing DNA studies do not have alien Gray DNA in their Data Bases, they are only comparing human DNA with human DNA. Keep in mind that 97% of our DNA is E.T. Junk DNA. We only use 3% of our DNA which is called our Active DNA. The E.T. Junk DNA was thought to be inactive and just riding along with our human DNA, now we know differently. Still in all, my guess would be that there is no match because they do not have the DNA genome of a Gray Alien in their Data Base.

    • MSH

      So, “they don’t have a match because the database doesn’t include DNA from a creature for which no known DNA exists”?

      Think about that.

      And then substitute “unicorn” for “creature”.

  3. Mark

    24 November, 2013 – 23:06 aprilholloway
    Ancient Humans Bred with Completely Unknown Species

    A new study presented to the Royal Society meeting on ancient DNA in London last week has revealed a dramatic finding – the genome of one of our ancient ancestors, the Denisovans, contains a segment of DNA that seems to have come from another species that is currently unknown to science. The discovery suggests that there was rampant interbreeding between ancient human species in Europe and Asia more than 30,000 years ago. But, far more significant was the finding that they also mated with a mystery species from Asia – one that is neither human nor Neanderthal.

    Scientists launched into a flurry of discussion and debate upon hearing the study results and immediately began speculating about what this unknown species could be. Some have suggested that a group may have branched off to Asia from the Homo heidelbernensis, who resided in Africa about half a million years ago. They are believed to be the ancestors of Europe’s Neanderthals.

    However others, such as Chris Stringer, a paleoanthropologist at the London Natural History Museum, admitted that they “don’t have the faintest idea” what the mystery species could be.

    Traces of the unknown new genome were detected in two teeth and a finger bone of a Denisovan, which was discovered in a Siberian cave. There is not much data available about the appearance of Denisovans due to lack of their fossils’ availability, but the geneticists and researchers succeeded in arranging their entire genome very precisely.

    “What it begins to suggest is that we’re looking at a ‘Lord of the Rings’-type world – that there were many hominid populations,” Mark Thomas, an evolutionary geneticist at University College London.

    The question is now: who were these mystery people that the Denisovans were breeding with?

    By April Holloway

    Read more: http://www.ancient-origins.net/news-evolution-human-origins/ancient-humans-bred-completely-unknown-species-001059#ixzz3cnvEqor5
    Follow us: @ancientorigins on Twitter | ancientoriginsweb on Facebook

    • MSH

      This of course refers to a species of hominid, not space aliens. That is, all parties concerned fall under/into the “human” category:

      http://www.nature.com/news/mystery-humans-spiced-up-ancients-sex-lives-1.14196

      The LOTR reference is kind of dumb. We don’t have inter-species breeding here, but variance in human populations (humans and non-humans can’t breed by the same genetic sciences). But it’s studies like this (which will be fought over, like earlier Neanderthal-homo sapiens mixed DNA study still is) that raise the question of multiple lines of humans. I blogged on that here way back with respect to the historical Adam topic (see the archive / search for that).

  4. Mark Fenton

    First off you can’t definatively state that it is not Alien DNA because by definition “Unkown” is just that unknown so we do not know were this DNA came from of what or whom it belongs too, open your mind my friend we humans are older and have been around a lot longer than modern science would have you believe. I am trying to let you in on the “TRUTH” so open up and accept it.

    • MSH

      Actually, I can. I can’t say “this is flying pig DNA” without knowing there was such a thing so that I could see the genes in the DNA that allowed for flight. Same for aliens. You need a known sample from which to get the genetic sequence that you can then identify as alien DNA. It’s pretty straightforward.

      Facts don’t close minds; they open them (when they are part of reality).